Transcript: Human NM_001282714.2

Homo sapiens family with sequence similarity 107 member A (FAM107A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
FAM107A (11170)
Length:
3615
CDS:
617..1144

Additional Resources:

NCBI RefSeq record:
NM_001282714.2
NBCI Gene record:
FAM107A (11170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158556 CCTAGCAAATTGTGTTGGTTA pLKO.1 2162 3UTR 100% 4.950 6.930 N FAM107A n/a
2 TRCN0000163950 CCCACCTGCTTCTGTAGAAAT pLKO.1 1253 3UTR 100% 13.200 9.240 N FAM107A n/a
3 TRCN0000160814 CCACACTGTTACGATGCAATT pLKO.1 2245 3UTR 100% 10.800 7.560 N FAM107A n/a
4 TRCN0000161777 CCAGAATACAGAGAGTGGAAT pLKO.1 764 CDS 100% 4.950 3.465 N FAM107A n/a
5 TRCN0000162215 CCAGCTCATCAAGAAGAAGAA pLKO.1 940 CDS 100% 4.950 3.465 N FAM107A n/a
6 TRCN0000160527 CCTAGTCTTATGGAAAGCAAA pLKO.1 2316 3UTR 100% 4.950 3.465 N FAM107A n/a
7 TRCN0000159879 GAGTTTATTAAAGTCAGGGAA pLKO.1 1076 CDS 100% 2.640 1.848 N FAM107A n/a
8 TRCN0000158710 GCCAATGAAATTGAAGAGGAA pLKO.1 3346 3UTR 100% 2.640 1.848 N FAM107A n/a
9 TRCN0000164464 CAAGAAGAAGAAGGAGGAGCT pLKO.1 949 CDS 100% 2.160 1.296 N FAM107A n/a
10 TRCN0000160096 CGAGTTTATTAAAGTCAGGGA pLKO.1 1075 CDS 100% 0.660 0.396 N FAM107A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02640 pDONR223 100% 82.2% 82.2% None 1_93del n/a
2 ccsbBroad304_02640 pLX_304 0% 82.2% 82.2% V5 1_93del n/a
3 TRCN0000466642 TAAAACCTATGCACGCATGGCATA pLX_317 73.8% 82.2% 82.2% V5 1_93del n/a
Download CSV