Transcript: Human NM_001282746.2

Homo sapiens armadillo repeat containing 3 (ARMC3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ARMC3 (219681)
Length:
2478
CDS:
56..2122

Additional Resources:

NCBI RefSeq record:
NM_001282746.2
NBCI Gene record:
ARMC3 (219681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422068 TATGATTATGGTCGGATAAAT pLKO_005 1772 CDS 100% 15.000 21.000 N ARMC3 n/a
2 TRCN0000165876 GCCCGGACTGAGTTAAGAAAT pLKO.1 1469 CDS 100% 13.200 18.480 N ARMC3 n/a
3 TRCN0000165331 GCACTTGCAGTGATAGCCAAT pLKO.1 812 CDS 100% 4.050 5.670 N ARMC3 n/a
4 TRCN0000433672 GTTGGTTATGGACGAAGTATT pLKO_005 1919 CDS 100% 13.200 10.560 N ARMC3 n/a
5 TRCN0000160509 CCCATTAATGATTGAAAGCAA pLKO.1 109 CDS 100% 3.000 2.400 N ARMC3 n/a
6 TRCN0000427095 AGGATGTGTTTGACCCATTAA pLKO_005 96 CDS 100% 13.200 9.240 N ARMC3 n/a
7 TRCN0000160546 CTGATGGTATTGATCCATTAA pLKO.1 1245 CDS 100% 13.200 9.240 N ARMC3 n/a
8 TRCN0000160619 CACCTTCATCTATGGAAGATA pLKO.1 1890 CDS 100% 5.625 3.938 N ARMC3 n/a
9 TRCN0000159099 GCTAAGAGACAATCAAGGATT pLKO.1 736 CDS 100% 4.950 3.465 N ARMC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09843 pDONR223 100% 77.7% 77.9% None 1877G>A;2046_2062del;2064_2065ins569 n/a
2 ccsbBroad304_09843 pLX_304 0% 77.7% 77.9% V5 1877G>A;2046_2062del;2064_2065ins569 n/a
3 TRCN0000470583 TCGGTCATTCCGGCTCTTCTCATG pLX_317 18.2% 77.7% 77.9% V5 1877G>A;2046_2062del;2064_2065ins569 n/a
Download CSV