Transcript: Human NM_001282754.2

Homo sapiens phosphate regulating endopeptidase homolog X-linked (PHEX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PHEX (5251)
Length:
6211
CDS:
682..2769

Additional Resources:

NCBI RefSeq record:
NM_001282754.2
NBCI Gene record:
PHEX (5251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434927 TAACCAGTATAGCAACTATTA pLKO_005 2538 CDS 100% 13.200 18.480 N PHEX n/a
2 TRCN0000419798 GTCAATGGTGCAATTAGTAAC pLKO_005 2753 CDS 100% 10.800 15.120 N PHEX n/a
3 TRCN0000047088 CCCGAAGATATGCCAAGCTAT pLKO.1 964 CDS 100% 4.950 6.930 N PHEX n/a
4 TRCN0000047091 CGTCCTACAAACTCGCAAGTA pLKO.1 2196 CDS 100% 4.950 6.930 N PHEX n/a
5 TRCN0000047090 GCTGAGATAATGATTCCACAT pLKO.1 1525 CDS 100% 4.050 5.670 N PHEX n/a
6 TRCN0000430149 TCAAAGTTGTAGGGCTTATAA pLKO_005 3013 3UTR 100% 15.000 10.500 N PHEX n/a
7 TRCN0000425038 TGCAACGTTTCGTGGTCAATA pLKO_005 1254 CDS 100% 13.200 9.240 N PHEX n/a
8 TRCN0000047092 CCAACTATTTGGTGTGGAGAA pLKO.1 1769 CDS 100% 4.050 2.835 N PHEX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01188 pDONR223 100% 92.4% 92.2% None (many diffs) n/a
2 ccsbBroad304_01188 pLX_304 0% 92.4% 92.2% V5 (many diffs) n/a
3 TRCN0000477264 GAGACAGACCGACAGGTCTTATAT pLX_317 10.2% 92.4% 92.2% V5 (many diffs) n/a
Download CSV