Transcript: Human NM_001282852.1

Homo sapiens cyclin Y (CCNY), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
CCNY (219771)
Length:
4636
CDS:
181..1131

Additional Resources:

NCBI RefSeq record:
NM_001282852.1
NBCI Gene record:
CCNY (219771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147455 GTCAACCAAACCTCAAGTATA pLKO.1 440 CDS 100% 13.200 18.480 N CCNY n/a
2 TRCN0000148204 GCGCAGACTTCCAAATAAATA pLKO.1 1659 3UTR 100% 15.000 10.500 N CCNY n/a
3 TRCN0000146675 CAGGACAAATAGCAAGGAAAT pLKO.1 377 CDS 100% 10.800 7.560 N CCNY n/a
4 TRCN0000180328 CGCTGTCTTCTGAGCTTTCTT pLKO.1 1713 3UTR 100% 5.625 3.938 N CCNY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05228 pDONR223 100% 87.8% 85.4% None (many diffs) n/a
2 ccsbBroad304_05228 pLX_304 0% 87.8% 85.4% V5 (many diffs) n/a
3 TRCN0000492295 CACGAGTGGCAGCAAAAACTGTGA pLX_317 45.2% 87.8% 85.4% V5 (many diffs) n/a
Download CSV