Transcript: Human NM_001282857.2

Homo sapiens 5'-3' exoribonuclease 1 (XRN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
XRN1 (54464)
Length:
10079
CDS:
94..5178

Additional Resources:

NCBI RefSeq record:
NM_001282857.2
NBCI Gene record:
XRN1 (54464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296741 CGATGTTGTACAAGGTATAAA pLKO_005 1963 CDS 100% 15.000 21.000 N XRN1 n/a
2 TRCN0000329112 CGATGTTGTACAAGGTATAAA pLKO_005 1963 CDS 100% 15.000 21.000 N Xrn1 n/a
3 TRCN0000049675 CCGATGTACTATTTGAAGTAT pLKO.1 3500 CDS 100% 5.625 7.875 N XRN1 n/a
4 TRCN0000049673 CGCATTATTAAACCCAGGAAA pLKO.1 310 CDS 100% 4.950 3.960 N XRN1 n/a
5 TRCN0000296760 ACACTATCATTGAGGAATAAT pLKO_005 5564 3UTR 100% 15.000 10.500 N XRN1 n/a
6 TRCN0000049677 CCCAATCTTGATGCTTTAATA pLKO.1 2776 CDS 100% 15.000 10.500 N XRN1 n/a
7 TRCN0000290746 CCCAATCTTGATGCTTTAATA pLKO_005 2776 CDS 100% 15.000 10.500 N XRN1 n/a
8 TRCN0000296739 GTTACTCACAGGTCGTAAATA pLKO_005 2490 CDS 100% 15.000 10.500 N XRN1 n/a
9 TRCN0000296746 TATTGATGAGAAGCGATTATT pLKO_005 1797 CDS 100% 15.000 10.500 N XRN1 n/a
10 TRCN0000049674 GCTGGTATTATCCTTATCATT pLKO.1 1526 CDS 100% 5.625 3.938 N XRN1 n/a
11 TRCN0000119942 GCCTCTTCTTTATGGAACATA pLKO.1 1014 CDS 100% 5.625 3.375 N Xrn1 n/a
12 TRCN0000049676 CCAGCCAGATTCTTCCAACAT pLKO.1 4959 CDS 100% 4.950 2.970 N XRN1 n/a
13 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 7253 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.