Transcript: Human NM_001282962.1

Homo sapiens Holliday junction recognition protein (HJURP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
HJURP (55355)
Length:
3027
CDS:
67..2151

Additional Resources:

NCBI RefSeq record:
NM_001282962.1
NBCI Gene record:
HJURP (55355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122235 GCAAGTATGGAAGTTCGATAT pLKO.1 1738 CDS 100% 10.800 15.120 N HJURP n/a
2 TRCN0000141465 CAAAGTGACACCCTCGAAGTA pLKO.1 1035 CDS 100% 4.950 6.930 N HJURP n/a
3 TRCN0000143078 CCAAGAGCGATTCATCTTCAT pLKO.1 1451 CDS 100% 4.950 6.930 N HJURP n/a
4 TRCN0000141593 CACGTCTTACAGGATGGAAGA pLKO.1 2085 CDS 100% 4.050 5.670 N HJURP n/a
5 TRCN0000142899 CCACTTGCTCTCTGTTTGTAT pLKO.1 2182 3UTR 100% 5.625 3.938 N HJURP n/a
6 TRCN0000144884 GAAGGAATCGTTACGATGAAA pLKO.1 1622 CDS 100% 5.625 3.938 N HJURP n/a
7 TRCN0000121523 CCTCGAAGTATTCTTCCTTGA pLKO.1 1046 CDS 100% 4.050 2.835 N HJURP n/a
8 TRCN0000142140 GAGCACAAAGCCATCAAGCAT pLKO.1 729 CDS 100% 3.000 2.100 N HJURP n/a
9 TRCN0000144040 CCTTTATGTATTGGAGTGTCT pLKO.1 1708 CDS 100% 2.640 1.848 N HJURP n/a
10 TRCN0000144237 CAGGGAAATAGTTCTGGAATA pLKO.1 1537 CDS 100% 10.800 6.480 N HJURP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12210 pDONR223 100% 69.4% 69.3% None 1_636del;722C>G n/a
2 ccsbBroad304_12210 pLX_304 0% 69.4% 69.3% V5 1_636del;722C>G n/a
3 TRCN0000470697 CTTTGAGGAACCTTACTGTCCGGT pLX_317 30% 69.4% 69.3% V5 1_636del;722C>G n/a
Download CSV