Transcript: Mouse NM_001282978.1

Mus musculus calcium channel, voltage-dependent, beta 1 subunit (Cacnb1), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Cacnb1 (12295)
Length:
1714
CDS:
203..1618

Additional Resources:

NCBI RefSeq record:
NM_001282978.1
NBCI Gene record:
Cacnb1 (12295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069050 CGAGGGAAGTCTCAATCCAAA pLKO.1 1253 CDS 100% 4.950 6.930 N Cacnb1 n/a
2 TRCN0000043790 CGGACAAATGTTGGCTACAAT pLKO.1 518 CDS 100% 5.625 4.500 N CACNB1 n/a
3 TRCN0000069051 CCTCGGATACAACATCCAACA pLKO.1 339 CDS 100% 4.050 3.240 N Cacnb1 n/a
4 TRCN0000430176 CCCGGGTAACAGCTGACATTT pLKO_005 978 CDS 100% 13.200 9.240 N Cacnb1 n/a
5 TRCN0000413544 GGACAAATGTTGGCTACAATC pLKO_005 519 CDS 100% 10.800 7.560 N Cacnb1 n/a
6 TRCN0000069049 CCCAGCAAACACATCATCATT pLKO.1 1028 CDS 100% 5.625 3.938 N Cacnb1 n/a
7 TRCN0000437762 GTACTGCAGAGGCTCATCAAA pLKO_005 1229 CDS 100% 5.625 3.938 N Cacnb1 n/a
8 TRCN0000069052 GCTCAGGAGAAATCTCAGCTT pLKO.1 1528 CDS 100% 2.640 1.848 N Cacnb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10707 pDONR223 100% 69.3% 70.2% None (many diffs) n/a
2 ccsbBroad304_10707 pLX_304 0% 69.3% 70.2% V5 (many diffs) n/a
3 TRCN0000466734 CGCCCTGATTCCAAAGGCTGCATG pLX_317 22% 69.3% 70.2% V5 (many diffs) n/a
Download CSV