Transcript: Human NM_001283015.2

Homo sapiens nudix hydrolase 13 (NUDT13), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NUDT13 (25961)
Length:
1989
CDS:
123..830

Additional Resources:

NCBI RefSeq record:
NM_001283015.2
NBCI Gene record:
NUDT13 (25961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050380 GCTGTCAACCTATGTTACTAA pLKO.1 179 CDS 100% 5.625 4.500 N NUDT13 n/a
2 TRCN0000050381 CTGATTAAGGAGTGGGTGGAA pLKO.1 1019 3UTR 100% 2.640 2.112 N NUDT13 n/a
3 TRCN0000050379 CAGGTGAACTTGAGAGAATTA pLKO.1 872 3UTR 100% 13.200 9.240 N NUDT13 n/a
4 TRCN0000306754 CAGGTGAACTTGAGAGAATTA pLKO_005 872 3UTR 100% 13.200 9.240 N NUDT13 n/a
5 TRCN0000296249 TCAGACTTCAGCACATCAATA pLKO_005 299 CDS 100% 13.200 9.240 N NUDT13 n/a
6 TRCN0000296248 TGTTACCCTTACAGAATTAAG pLKO_005 1513 3UTR 100% 13.200 9.240 N NUDT13 n/a
7 TRCN0000308136 TGGAAAGCCTGCAGTACTATG pLKO_005 771 CDS 100% 10.800 7.560 N NUDT13 n/a
8 TRCN0000050378 GCCTCCTTACACAAACCTGAA pLKO.1 480 CDS 100% 4.050 2.835 N NUDT13 n/a
9 TRCN0000289453 GCCTCCTTACACAAACCTGAA pLKO_005 480 CDS 100% 4.050 2.835 N NUDT13 n/a
10 TRCN0000050382 CTGGGTAAATTTGGACAGGAT pLKO.1 360 CDS 100% 2.640 1.584 N NUDT13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11791 pDONR223 100% 81.6% 75.1% None (many diffs) n/a
2 ccsbBroad304_11791 pLX_304 0% 81.6% 75.1% V5 (many diffs) n/a
3 TRCN0000474509 TAGATCGTTACGGAGTCTTCTTCA pLX_317 69.3% 81.6% 75.1% V5 (many diffs) n/a
Download CSV