Transcript: Human NM_001284220.2

Homo sapiens elongator acetyltransferase complex subunit 3 (ELP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ELP3 (55140)
Length:
3048
CDS:
193..1620

Additional Resources:

NCBI RefSeq record:
NM_001284220.2
NBCI Gene record:
ELP3 (55140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235509 ACCGAGTACAGAGGGATATTC pLKO_005 1064 CDS 100% 13.200 18.480 N ELP3 n/a
2 TRCN0000235508 TTACTGCATGAAGCGACATTT pLKO_005 651 CDS 100% 13.200 18.480 N ELP3 n/a
3 TRCN0000235507 TTACGAGGCAGTCAAGTATTC pLKO_005 579 CDS 100% 10.800 15.120 N ELP3 n/a
4 TRCN0000001281 CGATTACGCAAGTGTTCAGAA pLKO.1 1330 CDS 100% 4.950 3.960 N ELP3 n/a
5 TRCN0000235510 CACCATAACTCATGCAATAAA pLKO_005 1948 3UTR 100% 15.000 10.500 N ELP3 n/a
6 TRCN0000235511 GTGATGGGTGGAACGTTTATG pLKO_005 481 CDS 100% 13.200 9.240 N ELP3 n/a
7 TRCN0000001280 CGTGGGACTAGAAAGAGACAT pLKO.1 849 CDS 100% 4.950 3.465 N ELP3 n/a
8 TRCN0000001277 CCCTTTAACGACATACGCATT pLKO.1 2071 3UTR 100% 4.050 2.835 N ELP3 n/a
9 TRCN0000001279 CCTACAGACAAGACACCGAAT pLKO.1 411 CDS 100% 4.050 2.835 N ELP3 n/a
10 TRCN0000001278 GCCAGATATGACCCTTTCCTA pLKO.1 394 CDS 100% 3.000 2.100 N ELP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.