Transcript: Human NM_001284309.1

Homo sapiens ArfGAP with dual PH domains 1 (ADAP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ADAP1 (11033)
Length:
2135
CDS:
190..1098

Additional Resources:

NCBI RefSeq record:
NM_001284309.1
NBCI Gene record:
ADAP1 (11033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148260 GCACTTCAAGCATAAACCTTA pLKO.1 1077 CDS 100% 4.950 6.930 N ADAP1 n/a
2 TRCN0000180318 CCCACCTCCACGACTATTTAT pLKO.1 1543 3UTR 100% 15.000 10.500 N ADAP1 n/a
3 TRCN0000440044 TCGGGAATCCACCGGAATATC pLKO_005 106 5UTR 100% 13.200 9.240 N ADAP1 n/a
4 TRCN0000181086 CAGCACCCGTAACATCTTCAT pLKO.1 582 CDS 100% 4.950 3.465 N ADAP1 n/a
5 TRCN0000106153 CGGAAGTTTGTGCTGACAGAA pLKO.1 418 CDS 100% 4.950 3.465 N Adap1 n/a
6 TRCN0000437621 GTACGAGCGACAGGAGTTCAT pLKO_005 309 CDS 100% 4.950 3.465 N ADAP1 n/a
7 TRCN0000446284 ACGGACATTGGACTCACTGTG pLKO_005 1118 3UTR 100% 4.050 2.835 N ADAP1 n/a
8 TRCN0000429585 GATGAAGATCGAGCACCTGAA pLKO_005 495 CDS 100% 4.050 2.835 N ADAP1 n/a
9 TRCN0000148189 GCTCTGAAGTATTTCAACAGA pLKO.1 448 CDS 100% 3.000 2.100 N ADAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07731 pDONR223 100% 80.7% 80.7% None 0_1ins216 n/a
2 ccsbBroad304_07731 pLX_304 0% 80.7% 80.7% V5 0_1ins216 n/a
3 TRCN0000480735 GGCTAGCTGGATTGCCGGCAGTAA pLX_317 40.2% 80.7% 80.7% V5 0_1ins216 n/a
Download CSV