Transcript: Mouse NM_001284360.1

Mus musculus nitrogen permease regulator-like 3 (Nprl3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nprl3 (17168)
Length:
2735
CDS:
398..1747

Additional Resources:

NCBI RefSeq record:
NM_001284360.1
NBCI Gene record:
Nprl3 (17168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001284360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175195 CCATCAGTGATAAACTGTCTA pLKO.1 443 CDS 100% 4.950 6.930 N Nprl3 n/a
2 TRCN0000175864 GTCCTCCAAGTGCTATGATTA pLKO.1 1958 3UTR 100% 13.200 9.240 N Nprl3 n/a
3 TRCN0000176069 GCTATGGCTGATGCAAATGAA pLKO.1 572 CDS 100% 5.625 3.938 N Nprl3 n/a
4 TRCN0000176068 GCTACTCATGCTCTTTGACAA pLKO.1 1654 CDS 100% 4.950 3.465 N Nprl3 n/a
5 TRCN0000173381 GTCAACAACACTGGCGAACAT pLKO.1 309 5UTR 100% 4.950 3.465 N Nprl3 n/a
6 TRCN0000173171 CCACTGAACAAGAGGATGACA pLKO.1 1466 CDS 100% 3.000 2.100 N Nprl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01866 pDONR223 100% 76.7% 83.7% None (many diffs) n/a
2 ccsbBroad304_01866 pLX_304 0% 76.7% 83.7% V5 (many diffs) n/a
3 TRCN0000465315 ATCCGACCTACTTATATGGAAAGC pLX_317 32.3% 76.7% 83.7% V5 (many diffs) n/a
Download CSV