Transcript: Mouse NM_001285949.1

Mus musculus fasciculation and elongation protein zeta 2 (zygin II) (Fez2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fez2 (225020)
Length:
3767
CDS:
70..1107

Additional Resources:

NCBI RefSeq record:
NM_001285949.1
NBCI Gene record:
Fez2 (225020)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054634 CCAAGCTTGTTAACCGACTAT pLKO.1 1069 CDS 100% 4.950 3.960 N Fez2 n/a
2 TRCN0000335294 CCAAGCTTGTTAACCGACTAT pLKO_005 1069 CDS 100% 4.950 3.960 N Fez2 n/a
3 TRCN0000054633 CCATACAAGGACCTTGCATTT pLKO.1 381 CDS 100% 10.800 7.560 N Fez2 n/a
4 TRCN0000335291 CCATACAAGGACCTTGCATTT pLKO_005 381 CDS 100% 10.800 7.560 N Fez2 n/a
5 TRCN0000054635 CCAGGAGATTCAGACTCTCAA pLKO.1 639 CDS 100% 4.950 3.465 N Fez2 n/a
6 TRCN0000335227 CCAGGAGATTCAGACTCTCAA pLKO_005 639 CDS 100% 4.950 3.465 N Fez2 n/a
7 TRCN0000054637 CCTGACAGATAACTATGGGAA pLKO.1 333 CDS 100% 2.640 1.848 N Fez2 n/a
8 TRCN0000054636 CAGCTTCATTTCCGCTCTGAT pLKO.1 825 CDS 100% 4.950 2.970 N Fez2 n/a
9 TRCN0000335293 CAGCTTCATTTCCGCTCTGAT pLKO_005 825 CDS 100% 4.950 2.970 N Fez2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.