Transcript: Human NM_001286219.1

Homo sapiens transmembrane protein 132B (TMEM132B), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-10-24
Taxon:
Homo sapiens (human)
Gene:
TMEM132B (114795)
Length:
9659
CDS:
220..1992

Additional Resources:

NCBI RefSeq record:
NM_001286219.1
NBCI Gene record:
TMEM132B (114795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164387 CGTGGGTAAAGGAAATGTCAA pLKO.1 1092 CDS 100% 4.950 6.930 N TMEM132B n/a
2 TRCN0000161186 GATAAGTGAACCTTGTCAGAA pLKO.1 1047 CDS 100% 4.950 6.930 N TMEM132B n/a
3 TRCN0000163852 CGGTGACACCTTTAGACATTT pLKO.1 887 CDS 100% 13.200 10.560 N TMEM132B n/a
4 TRCN0000164042 CTGTTGACATTACACTCCCAT pLKO.1 1628 CDS 100% 2.640 2.112 N TMEM132B n/a
5 TRCN0000166355 CCAAGGAGGCAGCAATGATAT pLKO.1 1143 CDS 100% 13.200 9.240 N TMEM132B n/a
6 TRCN0000163894 CCTGTTTGACAGCGATGATAA pLKO.1 1887 CDS 100% 13.200 9.240 N TMEM132B n/a
7 TRCN0000164532 CTTGGGAATGAAGTGGAACTT pLKO.1 1597 CDS 100% 4.950 3.465 N TMEM132B n/a
8 TRCN0000165193 GCCAAGAGGAAAGTACCAACA pLKO.1 1271 CDS 100% 4.050 2.835 N TMEM132B n/a
9 TRCN0000165791 CCTGTTGACATTACACTCCCA pLKO.1 1627 CDS 100% 0.660 0.462 N TMEM132B n/a
10 TRCN0000164169 CAGTTTGACATCACTGACCTT pLKO.1 538 CDS 100% 2.640 1.584 N TMEM132B n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 7346 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 7343 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.