Transcript: Human NM_001286275.1

Homo sapiens KIAA1586 (KIAA1586), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
KIAA1586 (57691)
Length:
2942
CDS:
404..2566

Additional Resources:

NCBI RefSeq record:
NM_001286275.1
NBCI Gene record:
KIAA1586 (57691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283803 ACAGTCAAGATCAACTAATAT pLKO_005 1831 CDS 100% 15.000 21.000 N KIAA1586 n/a
2 TRCN0000268844 GAACCACATTTCGAGTATATT pLKO_005 515 CDS 100% 15.000 21.000 N KIAA1586 n/a
3 TRCN0000268805 GATGATTCTATATCCGAAATA pLKO_005 1484 CDS 100% 13.200 18.480 N KIAA1586 n/a
4 TRCN0000268846 ATGGCATGCATATCCTATATT pLKO_005 1687 CDS 100% 15.000 10.500 N KIAA1586 n/a
5 TRCN0000268845 TTGCTAGAGTGGGTCATAATA pLKO_005 2757 3UTR 100% 15.000 10.500 N KIAA1586 n/a
6 TRCN0000167850 GCGTTCTTTAAGAAGATAATC pLKO.1 2688 3UTR 100% 13.200 9.240 N KIAA1586 n/a
7 TRCN0000167500 GAACAACCAATCATTGAAGAA pLKO.1 536 CDS 100% 4.950 3.465 N KIAA1586 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03841 pDONR223 100% 91.4% 91.4% None 0_1ins201 n/a
2 ccsbBroad304_03841 pLX_304 0% 91.4% 91.4% V5 0_1ins201 n/a
3 TRCN0000471692 CCCACTTCGCTGCCACTTATGATG pLX_317 19.1% 91.4% 91.4% V5 0_1ins201 n/a
Download CSV