Transcript: Human NM_001286474.2

Homo sapiens testis expressed basic protein 1 (TSBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TSBP1 (10665)
Length:
2166
CDS:
198..1883

Additional Resources:

NCBI RefSeq record:
NM_001286474.2
NBCI Gene record:
TSBP1 (10665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142956 CCAGATACAAACCATATCCCA pLKO.1 1937 3UTR 100% 0.750 1.050 N TSBP1 n/a
2 TRCN0000141394 CCAAGTAACGAAGAGTGGGTT pLKO.1 1244 CDS 100% 2.640 3.432 N TSBP1 n/a
3 TRCN0000122197 GCCCATAAGACAAGTGATTAT pLKO.1 1901 3UTR 100% 13.200 9.240 N TSBP1 n/a
4 TRCN0000122021 GCACTAAAGAATGACATCATA pLKO.1 945 CDS 100% 5.625 3.938 N TSBP1 n/a
5 TRCN0000141245 CCAGCCATTGCCTAAACAGAT pLKO.1 1955 3UTR 100% 4.950 3.465 N TSBP1 n/a
6 TRCN0000144000 CGACATGCATATTCAACACAA pLKO.1 369 CDS 100% 4.950 3.465 N TSBP1 n/a
7 TRCN0000144791 GAATACCTCAAGTTCACACTA pLKO.1 772 CDS 100% 4.950 3.465 N TSBP1 n/a
8 TRCN0000142098 GAGGGAGTCAGTTGTACTGAA pLKO.1 1391 CDS 100% 4.950 3.465 N TSBP1 n/a
9 TRCN0000141823 GCCACAAACCTCAGTTTCCAA pLKO.1 2051 3UTR 100% 3.000 2.100 N TSBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07665 pDONR223 100% 92.1% 91.8% None (many diffs) n/a
2 ccsbBroad304_07665 pLX_304 0% 92.1% 91.8% V5 (many diffs) n/a
3 TRCN0000475721 CCTGATGAACCGTGAGTCAGTAAC pLX_317 19.6% 92.1% 91.8% V5 (many diffs) n/a
Download CSV