Transcript: Human NM_001286580.1

Homo sapiens potassium channel tetramerization domain containing 20 (KCTD20), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
KCTD20 (222658)
Length:
5369
CDS:
553..1377

Additional Resources:

NCBI RefSeq record:
NM_001286580.1
NBCI Gene record:
KCTD20 (222658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156423 CGAAGCAAATCCCTCACGAAT pLKO.1 1228 CDS 100% 4.950 6.930 N KCTD20 n/a
2 TRCN0000431856 GATGAACTTGACCGGCTAAAT pLKO_005 1315 CDS 100% 13.200 9.240 N KCTD20 n/a
3 TRCN0000157535 GCTCACACATTGGGTAGGAAT pLKO.1 2461 3UTR 100% 4.950 3.465 N KCTD20 n/a
4 TRCN0000153618 CCAGGTATGAAGTATGGCATA pLKO.1 3500 3UTR 100% 4.050 2.835 N KCTD20 n/a
5 TRCN0000152574 GCTTCTAACGACTTTCAGGAT pLKO.1 1354 CDS 100% 2.640 1.848 N KCTD20 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4474 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4826 3UTR 100% 4.050 2.025 Y P3H4 n/a
8 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4826 3UTR 100% 4.050 2.025 Y ORAI2 n/a
9 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4826 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4475 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.