Transcript: Human NM_001286805.1

Homo sapiens TBC1 domain family member 14 (TBC1D14), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
TBC1D14 (57533)
Length:
4026
CDS:
235..1296

Additional Resources:

NCBI RefSeq record:
NM_001286805.1
NBCI Gene record:
TBC1D14 (57533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150290 CCATTGGCAACGAGTTAAATA pLKO.1 455 CDS 100% 15.000 21.000 N TBC1D14 n/a
2 TRCN0000148002 GCCGAAATTATTTGCGCATTT pLKO.1 909 CDS 100% 10.800 15.120 N TBC1D14 n/a
3 TRCN0000365110 AGCCAGTCTGGAGCTTATTAA pLKO_005 594 CDS 100% 15.000 10.500 N TBC1D14 n/a
4 TRCN0000365109 GAGATGCTTTGGCTGATATTT pLKO_005 1685 3UTR 100% 15.000 10.500 N TBC1D14 n/a
5 TRCN0000370162 CTCCAGATATCTACCTAATTG pLKO_005 947 CDS 100% 13.200 9.240 N TBC1D14 n/a
6 TRCN0000365052 TAGCCATTGGCAACGAGTTAA pLKO_005 452 CDS 100% 13.200 9.240 N TBC1D14 n/a
7 TRCN0000147966 GCAGTGTTGATCTTGAACTTA pLKO.1 757 CDS 100% 5.625 3.938 N TBC1D14 n/a
8 TRCN0000150169 CATGGCCTTATGTTGACTTAT pLKO.1 853 CDS 100% 13.200 7.920 N TBC1D14 n/a
9 TRCN0000377457 GAGAAGAACAGACGCTCTTTA pLKO_005 1382 3UTR 100% 13.200 7.920 N TBC1D14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12360 pDONR223 100% 52% 52% None 0_1ins975;1047G>A n/a
2 ccsbBroad304_12360 pLX_304 0% 52% 52% V5 0_1ins975;1047G>A n/a
3 TRCN0000470728 GGCCTGTACTTCTGCCTAGTCGGA pLX_317 23.8% 52% 52% V5 0_1ins975;1047G>A n/a
Download CSV