Transcript: Human NM_001286828.1

Homo sapiens MORN repeat containing 5 (MORN5), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
MORN5 (254956)
Length:
615
CDS:
66..356

Additional Resources:

NCBI RefSeq record:
NM_001286828.1
NBCI Gene record:
MORN5 (254956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158241 CGAGGGTAGTCAAGGACTATA pLKO.1 348 CDS 100% 13.200 18.480 N MORN5 n/a
2 TRCN0000156816 GAAGCCAATACGACGCCATTT pLKO.1 217 CDS 100% 10.800 15.120 N MORN5 n/a
3 TRCN0000156502 CCCAAGGGCTATTACGATTGT pLKO.1 302 CDS 100% 4.950 6.930 N MORN5 n/a
4 TRCN0000155081 GTATGGCTCAACTCACCAATA pLKO.1 261 CDS 100% 10.800 7.560 N MORN5 n/a
5 TRCN0000151401 GAAATGAAGGATGGCATGTTT pLKO.1 165 CDS 100% 5.625 3.938 N MORN5 n/a
6 TRCN0000157404 GATTGTGGAGACGGCTTCTAT pLKO.1 317 CDS 100% 5.625 3.938 N MORN5 n/a
7 TRCN0000154760 GAATATGTAGATGGGAGGATG pLKO.1 96 CDS 100% 4.050 2.835 N MORN5 n/a
8 TRCN0000158087 CAAGGACTATAGGAACCGCTT pLKO.1 358 3UTR 100% 2.160 1.512 N MORN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05304 pDONR223 100% 59.6% 36.9% None 193_194ins112;288_289ins83 n/a
2 ccsbBroad304_05304 pLX_304 0% 59.6% 36.9% V5 193_194ins112;288_289ins83 n/a
3 TRCN0000481638 ACCTCACTTACGGACCGTAGACAC pLX_317 98.4% 59.6% 36.9% V5 193_194ins112;288_289ins83 n/a
Download CSV