Transcript: Human NM_001287237.1

Homo sapiens COMM domain containing 5 (COMMD5), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
COMMD5 (28991)
Length:
1588
CDS:
400..1074

Additional Resources:

NCBI RefSeq record:
NM_001287237.1
NBCI Gene record:
COMMD5 (28991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430916 GTGAGTGTTTGAACGTAATTA pLKO_005 1191 3UTR 100% 15.000 10.500 N COMMD5 n/a
2 TRCN0000439565 CTCACTTGACCAGTCCCATTC pLKO_005 1078 3UTR 100% 6.000 4.200 N COMMD5 n/a
3 TRCN0000118003 CAGGAGCACGTTCAGAAAGTT pLKO.1 531 CDS 100% 5.625 3.938 N COMMD5 n/a
4 TRCN0000118005 GATGTAGCAATCTCCACCAGT pLKO.1 877 CDS 100% 2.640 1.848 N COMMD5 n/a
5 TRCN0000118006 CACGTTCAGAAAGTTGCTGAA pLKO.1 537 CDS 100% 0.405 0.284 N COMMD5 n/a
6 TRCN0000118004 GCTGCCGCATGTTGCTGACTT pLKO.1 843 CDS 100% 1.650 0.990 N COMMD5 n/a
7 TRCN0000420440 GAGCGTCCTGATGCAGCTGAA pLKO_005 921 CDS 100% 1.350 0.810 N COMMD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03062 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03062 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_03061 pDONR223 100% 100% 100% None n/a
4 ccsbBroad304_03061 pLX_304 0% 100% 100% V5 n/a
5 TRCN0000474890 CTTGCGCGCAAAAATGACATCTTA pLX_317 47.8% 100% 100% V5 n/a
Download CSV