Transcript: Human NM_001287246.2

Homo sapiens BLM RecQ like helicase (BLM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
BLM (641)
Length:
5350
CDS:
210..4463

Additional Resources:

NCBI RefSeq record:
NM_001287246.2
NBCI Gene record:
BLM (641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273475 GACGCTAGACAGATAAGTTTA pLKO_005 1293 CDS 100% 13.200 18.480 N BLM n/a
2 TRCN0000004904 GCCTTTATTCAATACCCATTT pLKO.1 1676 CDS 100% 10.800 15.120 N BLM n/a
3 TRCN0000273474 GCCTTTATTCAATACCCATTT pLKO_005 1676 CDS 100% 10.800 15.120 N BLM n/a
4 TRCN0000004905 CCATCAATGATTGGGATGATA pLKO.1 658 CDS 100% 5.625 7.875 N BLM n/a
5 TRCN0000004906 CGCTTATGTGATGCTCGGAAA pLKO.1 3713 CDS 100% 4.050 5.670 N BLM n/a
6 TRCN0000273476 ACCGAATCTCAATGTACATAG pLKO_005 4466 3UTR 100% 10.800 8.640 N BLM n/a
7 TRCN0000004907 GCTACATATCTGACAGGTGAT pLKO.1 2409 CDS 100% 4.050 3.240 N BLM n/a
8 TRCN0000273473 GTGCAGCAGAAGTGGATTAAT pLKO_005 2997 CDS 100% 15.000 10.500 N BLM n/a
9 TRCN0000273477 TGAATATGCTGGTCGACATTT pLKO_005 3541 CDS 100% 13.200 9.240 N BLM n/a
10 TRCN0000004908 CGAAGGAAGTTGTATGCACTA pLKO.1 553 CDS 100% 4.050 2.835 N BLM n/a
11 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 5045 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05893 pDONR223 100% 99.9% 99.9% None 3157G>A n/a
2 ccsbBroad304_05893 pLX_304 0% 99.9% 99.9% V5 3157G>A n/a
3 TRCN0000477789 CTGTATGCCCATACCTTTTCTGAA pLX_317 11.4% 99.9% 99.9% V5 3157G>A n/a
Download CSV