Transcript: Human NM_001287737.1

Homo sapiens SET like protein (SETSIP), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SETSIP (646817)
Length:
1037
CDS:
32..940

Additional Resources:

NCBI RefSeq record:
NM_001287737.1
NBCI Gene record:
SETSIP (646817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425634 ATCAGGTTACAGAATAGATTT pLKO_005 457 CDS 100% 13.200 6.600 Y Set n/a
2 TRCN0000077186 GAGAGCTTCTTTACCTGGTTT pLKO.1 659 CDS 100% 4.950 2.475 Y Set n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01519 pDONR223 100% 83.7% 80.9% None (many diffs) n/a
2 ccsbBroad304_01519 pLX_304 0% 83.7% 80.9% V5 (many diffs) n/a
3 TRCN0000474477 TCAGCCTACCATCAACTTCGTATT pLX_317 68% 83.7% 80.9% V5 (many diffs) n/a
Download CSV