Transcript: Human NM_001288585.2

Homo sapiens lactamase beta (LACTB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LACTB (114294)
Length:
2942
CDS:
12..1010

Additional Resources:

NCBI RefSeq record:
NM_001288585.2
NBCI Gene record:
LACTB (114294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046623 GCAGGGAAACTGGATCTTGAT pLKO.1 549 CDS 100% 4.950 3.465 N LACTB n/a
2 TRCN0000290580 GCAGGGAAACTGGATCTTGAT pLKO_005 549 CDS 100% 4.950 3.465 N LACTB n/a
3 TRCN0000046626 CCGGGCATAGTGGTTGGAGTT pLKO.1 384 CDS 100% 1.350 0.945 N LACTB n/a
4 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1717 3UTR 100% 4.950 2.475 Y GJD4 n/a
5 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1717 3UTR 100% 4.950 2.475 Y C9orf85 n/a
6 TRCN0000221957 CTGTCACAACAAGATTACTAA pLKO.1 631 CDS 100% 5.625 7.875 N Lactb n/a
7 TRCN0000312337 CTGTCACAACAAGATTACTAA pLKO_005 631 CDS 100% 5.625 7.875 N Lactb n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1888 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04656 pDONR223 100% 60.6% 59.2% None 951_952insGGTA;996_997ins641 n/a
2 ccsbBroad304_04656 pLX_304 0% 60.6% 59.2% V5 951_952insGGTA;996_997ins641 n/a
3 TRCN0000480410 GCAGCTGGGACCTGCCTGCAGTCG pLX_317 25.3% 60.6% 59.2% V5 951_952insGGTA;996_997ins641 n/a
Download CSV