Transcript: Human NM_001288622.2

Homo sapiens islet cell autoantigen 1 like (ICA1L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ICA1L (130026)
Length:
7986
CDS:
156..1604

Additional Resources:

NCBI RefSeq record:
NM_001288622.2
NBCI Gene record:
ICA1L (130026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161050 GCACTGAACTTCTGAAGATAA pLKO.1 343 CDS 100% 13.200 18.480 N ICA1L n/a
2 TRCN0000161686 GATAATCAGTCAGTAGTCAGA pLKO.1 186 CDS 100% 2.640 3.696 N ICA1L n/a
3 TRCN0000136428 CATTCAGTCAAAGGGCAGTAT pLKO.1 562 CDS 100% 4.950 3.960 N ICA1L n/a
4 TRCN0000136230 GCAAGCTTTGAGAGTGAACAA pLKO.1 1044 CDS 100% 4.950 3.960 N ICA1L n/a
5 TRCN0000135258 CACTTTCAAACCCAGATGCTA pLKO.1 1549 CDS 100% 3.000 2.400 N ICA1L n/a
6 TRCN0000164224 CGAGAAATACCAGCTAAGACT pLKO.1 365 CDS 100% 3.000 2.400 N ICA1L n/a
7 TRCN0000255569 ATGCTTGACTGAAGTTATAAT pLKO_005 1597 CDS 100% 15.000 10.500 N ICA1L n/a
8 TRCN0000255567 GAGCATATCAGTAACTATATT pLKO_005 4457 3UTR 100% 15.000 10.500 N ICA1L n/a
9 TRCN0000255566 TGATACCTTGATGACAATTAA pLKO_005 584 CDS 100% 15.000 10.500 N ICA1L n/a
10 TRCN0000255568 CTTACTGAACAGCTCAATAAG pLKO_005 1002 CDS 100% 13.200 9.240 N ICA1L n/a
11 TRCN0000135472 GCTCGAATGATGTCCCAAATT pLKO.1 870 CDS 100% 13.200 9.240 N ICA1L n/a
12 TRCN0000265650 GCTGGACCCAGACACCTTAAA pLKO_005 671 CDS 100% 13.200 9.240 N ICA1L n/a
13 TRCN0000255571 TTTGTCAGAAAGTGGATTTAC pLKO_005 769 CDS 100% 13.200 9.240 N ICA1L n/a
14 TRCN0000255570 CTGCAATATGCTATCTCATTC pLKO_005 803 CDS 100% 10.800 7.560 N ICA1L n/a
15 TRCN0000134110 CGAATGATGTCCCAAATTCAT pLKO.1 873 CDS 100% 5.625 3.938 N ICA1L n/a
16 TRCN0000134741 GAGAGTGAACAAGCAAACAAA pLKO.1 1053 CDS 100% 5.625 3.938 N ICA1L n/a
17 TRCN0000163792 GCTGAACTGGATGCTAAACTT pLKO.1 294 CDS 100% 5.625 3.938 N ICA1L n/a
18 TRCN0000162572 CAGTAGTCAGAAGAATGCAAA pLKO.1 196 CDS 100% 4.950 3.465 N ICA1L n/a
19 TRCN0000135023 CCAACTTTAGACAGATGGTAA pLKO.1 1731 3UTR 100% 4.950 3.465 N ICA1L n/a
20 TRCN0000160646 CTTTATCAAAGCAACAGGAAA pLKO.1 242 CDS 100% 4.950 3.465 N ICA1L n/a
21 TRCN0000161229 GAAATACCAGCTAAGACTCAA pLKO.1 368 CDS 100% 4.950 3.465 N ICA1L n/a
22 TRCN0000265664 GCGGTAGCTCACGCCTATATA pLKO_005 5328 3UTR 100% 15.000 9.000 N ICA1L n/a
23 TRCN0000255572 GTACAGATGCAAGTGAGAAAT pLKO_005 714 CDS 100% 13.200 7.920 N ICA1L n/a
24 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3882 3UTR 100% 4.950 2.475 Y ORAI2 n/a
25 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3804 3UTR 100% 4.950 2.475 Y ERAP2 n/a
26 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 2977 3UTR 100% 4.950 2.475 Y CCDC30 n/a
27 TRCN0000133733 CTGTTCTTATTCCACTGGTTT pLKO.1 7227 3UTR 100% 4.950 2.475 Y PIGY n/a
28 TRCN0000134309 GAAAGCTCAAATGGATGGAAT pLKO.1 7475 3UTR 100% 4.950 2.475 Y PIGY n/a
29 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3805 3UTR 100% 13.200 6.600 Y LIAS n/a
30 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3879 3UTR 100% 4.950 2.475 Y LOC339059 n/a
31 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5505 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.