Transcript: Human NM_001288662.1

Homo sapiens collapsin response mediator protein 1 (CRMP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CRMP1 (1400)
Length:
3101
CDS:
405..2105

Additional Resources:

NCBI RefSeq record:
NM_001288662.1
NBCI Gene record:
CRMP1 (1400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046776 CGTCAATTCCTTCCAAGTCTA pLKO.1 866 CDS 100% 4.950 6.930 N CRMP1 n/a
2 TRCN0000291809 CGTCAATTCCTTCCAAGTCTA pLKO_005 866 CDS 100% 4.950 6.930 N CRMP1 n/a
3 TRCN0000046773 CGGATCATCAACGATGACCAA pLKO.1 453 CDS 100% 2.640 2.112 N CRMP1 n/a
4 TRCN0000291807 CGGATCATCAACGATGACCAA pLKO_005 453 CDS 100% 2.640 2.112 N CRMP1 n/a
5 TRCN0000046777 CACCAGTCCAACTTCAGCTTA pLKO.1 1989 CDS 100% 4.950 3.465 N CRMP1 n/a
6 TRCN0000291806 CACCAGTCCAACTTCAGCTTA pLKO_005 1989 CDS 100% 4.950 3.465 N CRMP1 n/a
7 TRCN0000046774 CCCGACAAGTTGAAGACCATA pLKO.1 1626 CDS 100% 4.950 3.465 N CRMP1 n/a
8 TRCN0000046775 CCTATAAGGATGTCTACCAAA pLKO.1 892 CDS 100% 4.950 3.465 N CRMP1 n/a
9 TRCN0000291808 CCTATAAGGATGTCTACCAAA pLKO_005 892 CDS 100% 4.950 3.465 N CRMP1 n/a
10 TRCN0000032618 GCCCAGATAGATGACAACAAT pLKO.1 2016 CDS 100% 5.625 3.375 N Crmp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469656 ATCGATTTATTTTAGCAGAAACGT pLX_317 21% 98.5% 97.5% V5 (many diffs) n/a
Download CSV