Transcript: Human NM_001288764.2

Homo sapiens DM1 protein kinase (DMPK), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DMPK (1760)
Length:
2858
CDS:
120..2087

Additional Resources:

NCBI RefSeq record:
NM_001288764.2
NBCI Gene record:
DMPK (1760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147274 ACACTGTCGGACATTCGGGA pXPR_003 AGG 1244 63% 10 0.5186 DMPK DMPK 75611
2 BRDN0001145527 CTTCTACGCGGATTCCACGG pXPR_003 CGG 925 47% 8 0.4214 DMPK DMPK 75608
3 BRDN0001146276 TCGAAATCCGGTGTAAAGGG pXPR_003 GGG 1137 58% 9 0.206 DMPK DMPK 75610
4 BRDN0001145673 CGGACGCGGGGCGTTCAGCG pXPR_003 AGG 325 17% 3 0.1733 DMPK DMPK 75609
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000812 GCCTGCTTACTCGGGAAATTT pLKO.1 2568 3UTR 100% 15.000 21.000 N DMPK n/a
2 TRCN0000412572 ACCTATCGTTGGTTCGCAAAG pLKO_005 2491 3UTR 100% 6.000 8.400 N DMPK n/a
3 TRCN0000199998 CTGGGTGTATTCGCCTATGAA pLKO.1 987 CDS 100% 5.625 7.875 N DMPK n/a
4 TRCN0000000815 CCCTTTACACCGGATTTCGAA pLKO.1 1254 CDS 100% 3.000 4.200 N DMPK n/a
5 TRCN0000199032 CCACCGACACATGCAACTTCG pLKO.1 1279 CDS 100% 1.350 1.890 N DMPK n/a
6 TRCN0000199349 CTGACACTGCTGAGCAAGTTT pLKO.1 666 CDS 100% 5.625 3.938 N DMPK n/a
7 TRCN0000199424 CCCATCGTGGTGAGGCTTAAG pLKO.1 363 CDS 100% 3.600 2.520 N DMPK n/a
8 TRCN0000000814 CCTGGTCATGGAGTATTACGT pLKO.1 632 CDS 100% 3.000 2.100 N DMPK n/a
9 TRCN0000000816 AGCGGTAGTGAAGATGAAGCA pLKO.1 452 CDS 100% 2.640 1.848 N DMPK n/a
10 TRCN0000000813 TCGAGACTTCATTCAGCGGTT pLKO.1 1127 CDS 100% 2.160 1.512 N DMPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489241 TTCGGCTCTAAATGTAATGGACCC pLX_317 22.4% 96% 87.6% V5 (not translated due to prior stop codon) 1_19del;179_237del n/a
2 TRCN0000489524 GTGAGGACTTACTTATACAACCCC pLX_317 23.1% 95.8% 76.9% V5 (not translated due to frame shift) 1_19del;179_237del;1726_1729delCTAG n/a
3 TRCN0000489443 ACCGGTCTCTGGCTTGCAATTCCA pLX_317 20.2% 95.7% 76.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV