Transcript: Human NM_001288765.1

Homo sapiens DM1 protein kinase (DMPK), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DMPK (1760)
Length:
2510
CDS:
113..1738

Additional Resources:

NCBI RefSeq record:
NM_001288765.1
NBCI Gene record:
DMPK (1760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000812 GCCTGCTTACTCGGGAAATTT pLKO.1 2212 3UTR 100% 15.000 21.000 N DMPK n/a
2 TRCN0000412572 ACCTATCGTTGGTTCGCAAAG pLKO_005 2135 3UTR 100% 6.000 8.400 N DMPK n/a
3 TRCN0000199998 CTGGGTGTATTCGCCTATGAA pLKO.1 635 CDS 100% 5.625 7.875 N DMPK n/a
4 TRCN0000000815 CCCTTTACACCGGATTTCGAA pLKO.1 902 CDS 100% 3.000 4.200 N DMPK n/a
5 TRCN0000199032 CCACCGACACATGCAACTTCG pLKO.1 927 CDS 100% 1.350 1.890 N DMPK n/a
6 TRCN0000199349 CTGACACTGCTGAGCAAGTTT pLKO.1 314 CDS 100% 5.625 3.938 N DMPK n/a
7 TRCN0000000814 CCTGGTCATGGAGTATTACGT pLKO.1 280 CDS 100% 3.000 2.100 N DMPK n/a
8 TRCN0000000816 AGCGGTAGTGAAGATGAAGCA pLKO.1 100 5UTR 100% 2.640 1.848 N DMPK n/a
9 TRCN0000000813 TCGAGACTTCATTCAGCGGTT pLKO.1 775 CDS 100% 2.160 1.512 N DMPK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489443 ACCGGTCTCTGGCTTGCAATTCCA pLX_317 20.2% 85.5% 85.5% V5 (not translated due to frame shift) 0_1ins267;1617_1623delTGAACCCinsG n/a
2 TRCN0000489524 GTGAGGACTTACTTATACAACCCC pLX_317 23.1% 85.5% 85.5% V5 (not translated due to frame shift) 0_1ins267;1617_1623delTGAACCC n/a
3 TRCN0000489241 TTCGGCTCTAAATGTAATGGACCC pLX_317 22.4% 85.3% 74.2% V5 (not translated due to prior stop codon) 0_1ins267;1380_1381insCTAG;1617_1623delTGAACCC n/a
Download CSV