Transcript: Human NM_001288968.1

Homo sapiens acyl-CoA synthetase family member 2 (ACSF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSF2 (80221)
Length:
2320
CDS:
105..2027

Additional Resources:

NCBI RefSeq record:
NM_001288968.1
NBCI Gene record:
ACSF2 (80221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141144 CCGCTCTAAGGATATGATCAT pLKO.1 1700 CDS 100% 4.950 6.930 N ACSF2 n/a
2 TRCN0000142266 GATTCCGAAGTACATCGTGTT pLKO.1 1922 CDS 100% 4.050 5.670 N ACSF2 n/a
3 TRCN0000142195 GCAATACTACAACGTCCTGAA pLKO.1 731 CDS 100% 4.050 5.670 N ACSF2 n/a
4 TRCN0000142516 GCATCTTAACAGCAAGACTGT pLKO.1 380 CDS 100% 2.640 3.696 N ACSF2 n/a
5 TRCN0000141722 GCAATTCAAGACCCAGCAATA pLKO.1 716 CDS 100% 10.800 7.560 N ACSF2 n/a
6 TRCN0000144425 CATTGTCAACAACTCCAACAT pLKO.1 1016 CDS 100% 4.950 3.465 N ACSF2 n/a
7 TRCN0000140532 GAAGACGTCAGGTTGACCTTT pLKO.1 465 CDS 100% 4.950 3.465 N ACSF2 n/a
8 TRCN0000142515 GAAGAGATTTGTGCCTGCATT pLKO.1 1827 CDS 100% 4.950 3.465 N ACSF2 n/a
9 TRCN0000140335 CGAGGACTTCTTTCACACACA pLKO.1 1754 CDS 100% 2.640 1.848 N ACSF2 n/a
10 TRCN0000144017 CCAGAAATTCAAACTTCGAGA pLKO.1 1979 CDS 100% 2.640 1.584 N ACSF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09017 pDONR223 100% 96% 96% None 129_203del;1401C>G n/a
2 ccsbBroad304_09017 pLX_304 0% 96% 96% V5 129_203del;1401C>G n/a
3 TRCN0000474575 CTAAAGCCCACGGGTCCGTTCCCC pLX_317 23.5% 96% 96% V5 129_203del;1401C>G n/a
4 ccsbBroadEn_09016 pDONR223 100% 95.9% 95.9% None 129_203del;299G>T;1401C>G n/a
5 ccsbBroad304_09016 pLX_304 0% 95.9% 95.9% V5 129_203del;299G>T;1401C>G n/a
6 TRCN0000471745 CAATTCAAGCAATGTCCCCGTCTA pLX_317 24.5% 95.9% 95.9% V5 129_203del;299G>T;1401C>G n/a
Download CSV