Transcript: Human NM_001288969.1

Homo sapiens acyl-CoA synthetase family member 2 (ACSF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSF2 (80221)
Length:
2206
CDS:
105..1913

Additional Resources:

NCBI RefSeq record:
NM_001288969.1
NBCI Gene record:
ACSF2 (80221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141144 CCGCTCTAAGGATATGATCAT pLKO.1 1586 CDS 100% 4.950 6.930 N ACSF2 n/a
2 TRCN0000142266 GATTCCGAAGTACATCGTGTT pLKO.1 1808 CDS 100% 4.050 5.670 N ACSF2 n/a
3 TRCN0000142195 GCAATACTACAACGTCCTGAA pLKO.1 617 CDS 100% 4.050 5.670 N ACSF2 n/a
4 TRCN0000142516 GCATCTTAACAGCAAGACTGT pLKO.1 305 CDS 100% 2.640 3.696 N ACSF2 n/a
5 TRCN0000141722 GCAATTCAAGACCCAGCAATA pLKO.1 602 CDS 100% 10.800 7.560 N ACSF2 n/a
6 TRCN0000144425 CATTGTCAACAACTCCAACAT pLKO.1 902 CDS 100% 4.950 3.465 N ACSF2 n/a
7 TRCN0000140532 GAAGACGTCAGGTTGACCTTT pLKO.1 390 CDS 100% 4.950 3.465 N ACSF2 n/a
8 TRCN0000142515 GAAGAGATTTGTGCCTGCATT pLKO.1 1713 CDS 100% 4.950 3.465 N ACSF2 n/a
9 TRCN0000140335 CGAGGACTTCTTTCACACACA pLKO.1 1640 CDS 100% 2.640 1.848 N ACSF2 n/a
10 TRCN0000144017 CCAGAAATTCAAACTTCGAGA pLKO.1 1865 CDS 100% 2.640 1.584 N ACSF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09017 pDONR223 100% 97.8% 97.8% None 434_435ins39;1287C>G n/a
2 ccsbBroad304_09017 pLX_304 0% 97.8% 97.8% V5 434_435ins39;1287C>G n/a
3 TRCN0000474575 CTAAAGCCCACGGGTCCGTTCCCC pLX_317 23.5% 97.8% 97.8% V5 434_435ins39;1287C>G n/a
4 ccsbBroadEn_09016 pDONR223 100% 97.7% 97.7% None 224G>T;434_435ins39;1287C>G n/a
5 ccsbBroad304_09016 pLX_304 0% 97.7% 97.7% V5 224G>T;434_435ins39;1287C>G n/a
6 TRCN0000471745 CAATTCAAGCAATGTCCCCGTCTA pLX_317 24.5% 97.7% 97.7% V5 224G>T;434_435ins39;1287C>G n/a
Download CSV