Transcript: Human NM_001289.6

Homo sapiens chloride intracellular channel 2 (CLIC2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CLIC2 (1193)
Length:
2623
CDS:
188..931

Additional Resources:

NCBI RefSeq record:
NM_001289.6
NBCI Gene record:
CLIC2 (1193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412487 TTACCCAAGCTGAACATTATT pLKO_005 746 CDS 100% 15.000 21.000 N CLIC2 n/a
2 TRCN0000425336 TCTCAGGAGTCTGGCGTTATC pLKO_005 813 CDS 100% 10.800 15.120 N CLIC2 n/a
3 TRCN0000045138 GCCAAGAAATATCGTGACTTT pLKO.1 776 CDS 100% 4.950 3.960 N CLIC2 n/a
4 TRCN0000427683 AGCATATCAGAGAGGCAAATT pLKO_005 1391 3UTR 100% 13.200 9.240 N CLIC2 n/a
5 TRCN0000045139 CCCAGTTTCCAGAAGACTATT pLKO.1 685 CDS 100% 13.200 9.240 N CLIC2 n/a
6 TRCN0000045141 CCTCTGGCTTAAAGGAGTTAA pLKO.1 304 CDS 100% 13.200 9.240 N CLIC2 n/a
7 TRCN0000045140 CCTGAAGAACTAAAGGACTTA pLKO.1 359 CDS 100% 4.950 3.465 N CLIC2 n/a
8 TRCN0000045142 GCGTCTGGATGACTACTTAAA pLKO.1 619 CDS 100% 13.200 7.920 N CLIC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00325 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00325 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475245 CCCTTATTTTGAAATGTAAGGAAC pLX_317 46.1% 100% 100% V5 n/a
Download CSV