Transcript: Human NM_001289094.1

Homo sapiens histidyl-tRNA synthetase 1 (HARS1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-07-17
Taxon:
Homo sapiens (human)
Gene:
HARS1 (3035)
Length:
2219
CDS:
424..1866

Additional Resources:

NCBI RefSeq record:
NM_001289094.1
NBCI Gene record:
HARS1 (3035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045726 CGAGAAGGTGTTTGACGTAAT pLKO.1 555 CDS 100% 10.800 15.120 N HARS1 n/a
2 TRCN0000286308 CGAGAAGGTGTTTGACGTAAT pLKO_005 555 CDS 100% 10.800 15.120 N HARS1 n/a
3 TRCN0000045727 CGCATTCTAGATGGGATGTTT pLKO.1 979 CDS 100% 5.625 7.875 N HARS1 n/a
4 TRCN0000286240 CGCATTCTAGATGGGATGTTT pLKO_005 979 CDS 100% 5.625 7.875 N HARS1 n/a
5 TRCN0000045723 GCTCGGTATTTGGCAATGAAT pLKO.1 742 CDS 100% 5.625 7.875 N HARS1 n/a
6 TRCN0000045724 GCTACCACATAGCAAAGGTAT pLKO.1 782 CDS 100% 4.950 6.930 N HARS1 n/a
7 TRCN0000293749 AGTCATTGATACACCTGTATT pLKO_005 606 CDS 100% 13.200 9.240 N HARS1 n/a
8 TRCN0000293690 GAAGTGGGACTGGCACTATTT pLKO_005 1891 3UTR 100% 13.200 9.240 N HARS1 n/a
9 TRCN0000337578 TGAATAAACTGACCAACATTA pLKO_005 758 CDS 100% 13.200 9.240 N Hars n/a
10 TRCN0000293750 TTGAGTACCTGACCCTATTTG pLKO_005 1253 CDS 100% 13.200 9.240 N HARS1 n/a
11 TRCN0000045725 GCTGTACAAGAAGAACCCAAA pLKO.1 1656 CDS 100% 4.050 2.835 N HARS1 n/a
12 TRCN0000075904 CCAACATTAAACGCTACCATA pLKO.1 770 CDS 100% 4.950 6.930 N Hars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06351 pDONR223 100% 94.1% 93.9% None 1_1delAins88;9G>T n/a
2 ccsbBroad304_06351 pLX_304 0% 94.1% 93.9% V5 1_1delAins88;9G>T n/a
3 TRCN0000465701 TCAATTTGCCATGGTTGCTACTTT pLX_317 24.8% 94.1% 93.9% V5 1_1delAins88;9G>T n/a
Download CSV