Transcript: Human NM_001289179.2

Homo sapiens acyl-CoA synthetase bubblegum family member 2 (ACSBG2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSBG2 (81616)
Length:
2650
CDS:
275..2191

Additional Resources:

NCBI RefSeq record:
NM_001289179.2
NBCI Gene record:
ACSBG2 (81616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289179.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164121 CCGATGACCATCCCTGAATTT pLKO.1 422 CDS 100% 13.200 18.480 N ACSBG2 n/a
2 TRCN0000164436 CGAGAGTCAGTCAACCGATTT pLKO.1 446 CDS 100% 10.800 15.120 N ACSBG2 n/a
3 TRCN0000160567 CCATACGTTTCAAAGCAATAA pLKO.1 2370 3UTR 100% 13.200 9.240 N ACSBG2 n/a
4 TRCN0000163563 GCACATCTTCATGGGCTATCT pLKO.1 1681 CDS 100% 4.950 3.465 N ACSBG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289179.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09076 pDONR223 100% 95.5% 95.3% None (many diffs) n/a
2 ccsbBroad304_09076 pLX_304 0% 95.5% 95.3% V5 (many diffs) n/a
3 TRCN0000476545 ATGAAGTAGCAATAATACTGAAAT pLX_317 19.8% 95.5% 95.3% V5 (many diffs) n/a
Download CSV