Transcript: Human NM_001289410.1

Homo sapiens family with sequence similarity 104 member A (FAM104A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
FAM104A (84923)
Length:
2742
CDS:
89..400

Additional Resources:

NCBI RefSeq record:
NM_001289410.1
NBCI Gene record:
FAM104A (84923)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144351 CGTACTGAAATGAAACGTGTA pLKO.1 2373 3UTR 100% 4.050 5.670 N FAM104A n/a
2 TRCN0000140299 GCTAACCTAATGTGGGCAGAA pLKO.1 2026 3UTR 100% 4.050 3.240 N FAM104A n/a
3 TRCN0000140995 CGGAAAGGATACACTGCTAAT pLKO.1 2222 3UTR 100% 10.800 7.560 N FAM104A n/a
4 TRCN0000141599 CCTGTGTAACAGGAGAACAAT pLKO.1 1082 3UTR 100% 5.625 3.938 N FAM104A n/a
5 TRCN0000144914 GCAGTTGTTTACTTGTGGTTT pLKO.1 694 3UTR 100% 4.950 3.465 N FAM104A n/a
6 TRCN0000139625 CTACTTCCACATCAACCAGAC pLKO.1 474 3UTR 100% 2.250 1.350 N FAM104A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12882 pDONR223 100% 31.9% 13.3% None (many diffs) n/a
2 ccsbBroad304_12882 pLX_304 0% 31.9% 13.3% V5 (many diffs) n/a
3 TRCN0000470471 GTCCGCCCCAAAGCGACTCGAATT pLX_317 81% 31.9% 13.3% V5 (many diffs) n/a
Download CSV