Transcript: Mouse NM_001289494.1

Mus musculus TXK tyrosine kinase (Txk), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Txk (22165)
Length:
2194
CDS:
84..1601

Additional Resources:

NCBI RefSeq record:
NM_001289494.1
NBCI Gene record:
Txk (22165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361492 CCTAAAGGCCGTCCGACATTT pLKO_005 1536 CDS 100% 13.200 18.480 N Txk n/a
2 TRCN0000361503 TTCGAGGTTAGTTCAACTTTA pLKO_005 986 CDS 100% 13.200 18.480 N Txk n/a
3 TRCN0000023600 CGTGAGAGATTCGAGACACTT pLKO.1 539 CDS 100% 4.950 6.930 N Txk n/a
4 TRCN0000361562 CAGTTCTGCCTGCGTAGTAAA pLKO_005 1211 CDS 100% 13.200 10.560 N Txk n/a
5 TRCN0000023423 CGTAGTAAAGATCTCAGACTT pLKO.1 1223 CDS 100% 4.950 3.960 N Gm1893 n/a
6 TRCN0000023419 GCCCACCTGAAGTCTTTCATT pLKO.1 1315 CDS 100% 5.625 3.938 N Gm1893 n/a
7 TRCN0000023603 GAAGGCATACACAGTCTTCAA pLKO.1 595 CDS 100% 4.950 3.465 N Txk n/a
8 TRCN0000023421 GACCATATACAGAGTGATGTA pLKO.1 1496 CDS 100% 4.950 3.465 N Gm1893 n/a
9 TRCN0000023599 GCCTGGTAATTTGGCACTGAA pLKO.1 374 CDS 100% 4.950 3.465 N Txk n/a
10 TRCN0000023422 GTGATGATGAAACTGTCACAT pLKO.1 966 CDS 100% 4.950 3.465 N Gm1893 n/a
11 TRCN0000023420 CCAGGAACTGTTTGGTCAGTT pLKO.1 1195 CDS 100% 0.495 0.347 N Gm1893 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.