Transcript: Mouse NM_001289495.1

Mus musculus TXK tyrosine kinase (Txk), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Txk (22165)
Length:
2277
CDS:
263..1684

Additional Resources:

NCBI RefSeq record:
NM_001289495.1
NBCI Gene record:
Txk (22165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361492 CCTAAAGGCCGTCCGACATTT pLKO_005 1619 CDS 100% 13.200 18.480 N Txk n/a
2 TRCN0000361503 TTCGAGGTTAGTTCAACTTTA pLKO_005 1069 CDS 100% 13.200 18.480 N Txk n/a
3 TRCN0000023602 GCCAACTTAGAAATCTATGAA pLKO.1 527 CDS 100% 5.625 7.875 N Txk n/a
4 TRCN0000023600 CGTGAGAGATTCGAGACACTT pLKO.1 622 CDS 100% 4.950 6.930 N Txk n/a
5 TRCN0000361562 CAGTTCTGCCTGCGTAGTAAA pLKO_005 1294 CDS 100% 13.200 10.560 N Txk n/a
6 TRCN0000023423 CGTAGTAAAGATCTCAGACTT pLKO.1 1306 CDS 100% 4.950 3.960 N Gm1893 n/a
7 TRCN0000023601 GCTTCGGGAATGAAGGCTTAA pLKO.1 474 CDS 100% 10.800 7.560 N Txk n/a
8 TRCN0000023419 GCCCACCTGAAGTCTTTCATT pLKO.1 1398 CDS 100% 5.625 3.938 N Gm1893 n/a
9 TRCN0000023603 GAAGGCATACACAGTCTTCAA pLKO.1 678 CDS 100% 4.950 3.465 N Txk n/a
10 TRCN0000023421 GACCATATACAGAGTGATGTA pLKO.1 1579 CDS 100% 4.950 3.465 N Gm1893 n/a
11 TRCN0000023599 GCCTGGTAATTTGGCACTGAA pLKO.1 391 CDS 100% 4.950 3.465 N Txk n/a
12 TRCN0000023422 GTGATGATGAAACTGTCACAT pLKO.1 1049 CDS 100% 4.950 3.465 N Gm1893 n/a
13 TRCN0000023420 CCAGGAACTGTTTGGTCAGTT pLKO.1 1278 CDS 100% 0.495 0.347 N Gm1893 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.