Transcript: Mouse NM_001289521.1

Mus musculus zinc finger E-box binding homeobox 2 (Zeb2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Zeb2 (24136)
Length:
8898
CDS:
190..3837

Additional Resources:

NCBI RefSeq record:
NM_001289521.1
NBCI Gene record:
Zeb2 (24136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226283 CGAAGCGACACGGCCATTATT pLKO_005 694 CDS 100% 15.000 21.000 N Zeb2 n/a
2 TRCN0000226284 CTAGACTTCAATGACTATAAA pLKO_005 1372 CDS 100% 15.000 21.000 N Zeb2 n/a
3 TRCN0000218861 ATGCAATTTAGCCACTAATAG pLKO_005 6891 3UTR 100% 13.200 18.480 N Zeb2 n/a
4 TRCN0000070884 CCGAATGAGAAACAATATCAA pLKO.1 1215 CDS 100% 5.625 4.500 N Zeb2 n/a
5 TRCN0000219028 AGAGAACCCAAAGGTATTATA pLKO_005 2662 CDS 100% 15.000 10.500 N Zeb2 n/a
6 TRCN0000226285 CAGTTCCCTTCTGCGACATAA pLKO_005 3222 CDS 100% 13.200 9.240 N Zeb2 n/a
7 TRCN0000013528 GCAGTTCCTTAGTTTACATAT pLKO.1 4677 3UTR 100% 13.200 9.240 N ZEB2 n/a
8 TRCN0000413910 GTGTGGTTCAGAGACTAATTC pLKO_005 4067 3UTR 100% 13.200 9.240 N ZEB2 n/a
9 TRCN0000070886 CCAGTGTCAGATTTGTAAGAA pLKO.1 3270 CDS 100% 5.625 3.938 N Zeb2 n/a
10 TRCN0000070883 CCACTAGACTTCAATGACTAT pLKO.1 1369 CDS 100% 4.950 3.465 N Zeb2 n/a
11 TRCN0000070887 CCCATTTAGTGCCAAGCCTTT pLKO.1 2850 CDS 100% 4.050 2.835 N Zeb2 n/a
12 TRCN0000070885 CCTCAGGAATTTGTGAAGGAA pLKO.1 2239 CDS 100% 3.000 2.100 N Zeb2 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6202 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.