Transcript: Mouse NM_001289594.1

Mus musculus kynureninase (L-kynurenine hydrolase) (Kynu), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Kynu (70789)
Length:
2807
CDS:
96..1070

Additional Resources:

NCBI RefSeq record:
NM_001289594.1
NBCI Gene record:
Kynu (70789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195774 CCTAGCACATGCAGTTGGAAA pLKO.1 848 CDS 100% 4.950 3.960 N Kynu n/a
2 TRCN0000246655 GGATGATGATGCCATCTATTT pLKO_005 290 CDS 100% 13.200 9.240 N Kynu n/a
3 TRCN0000217189 CATCTCCTGCTGTTATCATTC pLKO.1 522 CDS 100% 10.800 7.560 N Kynu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02052 pDONR223 100% 80.9% 79.6% None (many diffs) n/a
2 ccsbBroad304_02052 pLX_304 0% 80.9% 79.6% V5 (many diffs) n/a
3 TRCN0000472118 GGGCGCATCCCAGTACGAATTCCG pLX_317 45.9% 80.9% 79.6% V5 (many diffs) n/a
Download CSV