Transcript: Mouse NM_001289723.1

Mus musculus WAS/WASL interacting protein family, member 1 (Wipf1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Wipf1 (215280)
Length:
4451
CDS:
170..1651

Additional Resources:

NCBI RefSeq record:
NM_001289723.1
NBCI Gene record:
Wipf1 (215280)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422805 GATTCTACTTCCATCCGATTT pLKO_005 1497 CDS 100% 10.800 15.120 N WIPF1 n/a
2 TRCN0000418002 TCCTGAGCTATTGCTTGTATC pLKO_005 1849 3UTR 100% 10.800 15.120 N Wipf1 n/a
3 TRCN0000445424 ACCGCCAACAGGGATAATGAT pLKO_005 512 CDS 100% 5.625 7.875 N Wipf1 n/a
4 TRCN0000423142 GCCGAAGTGGATCCAACAGAA pLKO_005 1590 CDS 100% 4.950 6.930 N Wipf1 n/a
5 TRCN0000445638 GGTTACAGAACGTCCGATCTT pLKO_005 2031 3UTR 100% 4.950 6.930 N Wipf1 n/a
6 TRCN0000184459 GTACCGACAACCAAGACGTAT pLKO.1 1544 CDS 100% 0.000 0.000 N Wipf1 n/a
7 TRCN0000195856 CCCTCCACATCAGTTCGAAAT pLKO.1 1436 CDS 100% 10.800 7.560 N Wipf1 n/a
8 TRCN0000436021 CGTTCTACCCAAGCTCCAAAG pLKO_005 1665 3UTR 100% 6.000 4.200 N Wipf1 n/a
9 TRCN0000183384 GCCTAGCTGTTTATGTTGTAT pLKO.1 1824 3UTR 100% 5.625 3.938 N Wipf1 n/a
10 TRCN0000425268 TCCAGCTTCCAACGACGAGAT pLKO_005 1111 CDS 100% 4.050 2.835 N Wipf1 n/a
11 TRCN0000183172 GAAAGCAGATTCTACTTCCAT pLKO.1 1490 CDS 100% 3.000 1.800 N Wipf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.