Transcript: Mouse NM_001289781.1

Mus musculus pseudouridylate synthase 7 (Pus7), transcript variant 2, mRNA.

Source:
NCBI, updated 2016-01-27
Taxon:
Mus musculus (mouse)
Gene:
Pus7 (78697)
Length:
4258
CDS:
584..2566

Additional Resources:

NCBI RefSeq record:
NM_001289781.1
NBCI Gene record:
Pus7 (78697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247329 CCGGCTTCATTAACTACTATG pLKO_005 1686 CDS 100% 10.800 15.120 N Pus7 n/a
2 TRCN0000177519 CGATTCGAGATTACTCCTTAT pLKO.1 2271 CDS 100% 10.800 15.120 N Pus7 n/a
3 TRCN0000247331 CGATTCGAGATTACTCCTTAT pLKO_005 2271 CDS 100% 10.800 15.120 N Pus7 n/a
4 TRCN0000247330 GAACTTGAAGCTCGGGAATTT pLKO_005 1543 CDS 100% 13.200 10.560 N Pus7 n/a
5 TRCN0000247328 ACAAGTCCTGAGGATCCTAAT pLKO_005 2736 3UTR 100% 10.800 8.640 N Pus7 n/a
6 TRCN0000217281 CAAGTCCTGAGGATCCTAATT pLKO.1 2737 3UTR 100% 13.200 9.240 N Pus7 n/a
7 TRCN0000217104 CCAAGAAACAATCGCTTAATG pLKO.1 1982 CDS 100% 13.200 9.240 N Pus7 n/a
8 TRCN0000247332 TCCAAGAAACAATCGCTTAAT pLKO_005 1981 CDS 100% 13.200 9.240 N Pus7 n/a
9 TRCN0000216823 GACTTTGTCGTTCACGAAATC pLKO.1 986 CDS 100% 10.800 7.560 N Pus7 n/a
10 TRCN0000198752 CCCACCTACATTGAGGAAGAT pLKO.1 2111 CDS 100% 4.950 3.465 N Pus7 n/a
11 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 4074 3UTR 100% 2.640 1.320 Y Adsl n/a
12 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 4074 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12049 pDONR223 100% 34.1% 36.6% None (many diffs) n/a
2 ccsbBroad304_12049 pLX_304 0% 34.1% 36.6% V5 (many diffs) n/a
3 TRCN0000467597 AACACGGAGAAACTCTCCCACCTT pLX_317 62.4% 34.1% 36.6% V5 (many diffs) n/a
Download CSV