Transcript: Human NM_001289940.1

Homo sapiens solute carrier family 1 member 3 (SLC1A3), transcript variant GLAST1c, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
SLC1A3 (6507)
Length:
3852
CDS:
477..1769

Additional Resources:

NCBI RefSeq record:
NM_001289940.1
NBCI Gene record:
SLC1A3 (6507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421606 ATGTTAGTCTTACCGAATAAG pLKO_005 1986 3UTR 100% 13.200 18.480 N SLC1A3 n/a
2 TRCN0000043194 CCGACCATACAGAATGAGCTA pLKO.1 680 CDS 100% 2.640 3.696 N SLC1A3 n/a
3 TRCN0000043197 GCGAGCTGTAGTCTATTATAT pLKO.1 839 CDS 100% 15.000 12.000 N SLC1A3 n/a
4 TRCN0000434047 TGTGGCACACAATCCTATAAA pLKO_005 2050 3UTR 100% 15.000 10.500 N SLC1A3 n/a
5 TRCN0000431078 TGAACTGAACTTCGGACAAAT pLKO_005 1397 CDS 100% 13.200 9.240 N SLC1A3 n/a
6 TRCN0000414023 TGCTGTGGTGATTGGCATAAT pLKO_005 875 CDS 100% 13.200 9.240 N Slc1a3 n/a
7 TRCN0000043193 CGACAGTGAAACCAAGATGTA pLKO.1 1748 CDS 100% 4.950 3.465 N SLC1A3 n/a
8 TRCN0000043196 CCACTCCTCTACTTCTTGGTA pLKO.1 1140 CDS 100% 3.000 2.100 N SLC1A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289940.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06955 pDONR223 100% 79.2% 79.1% None 67C>A;523_524ins336;1110C>A n/a
2 ccsbBroad304_06955 pLX_304 0% 79.2% 79.1% V5 67C>A;523_524ins336;1110C>A n/a
Download CSV