Transcript: Human NM_001289999.1

Homo sapiens nuclear factor, interleukin 3 regulated (NFIL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NFIL3 (4783)
Length:
2247
CDS:
539..1927

Additional Resources:

NCBI RefSeq record:
NM_001289999.1
NBCI Gene record:
NFIL3 (4783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014741 CAGATCAAAGTAGAAGCCTTT pLKO.1 1541 CDS 100% 4.050 5.670 N NFIL3 n/a
2 TRCN0000234571 GCTTCAGACTCTGGGTAAATT pLKO_005 1910 CDS 100% 15.000 10.500 N NFIL3 n/a
3 TRCN0000234570 CCTATTGACATGACATCTAAA pLKO_005 1598 CDS 100% 13.200 9.240 N NFIL3 n/a
4 TRCN0000234568 GACAAGATGATGGTCCTTAAT pLKO_005 605 CDS 100% 13.200 9.240 N NFIL3 n/a
5 TRCN0000014742 TGGTCCTTAATTCTGCTTTAA pLKO.1 615 CDS 100% 13.200 9.240 N NFIL3 n/a
6 TRCN0000234572 TTGCAATAGAGCAGTCCATTT pLKO_005 1969 3UTR 100% 10.800 7.560 N NFIL3 n/a
7 TRCN0000014738 GCACAGATTATGATGAAGATT pLKO.1 2071 3UTR 100% 5.625 3.938 N NFIL3 n/a
8 TRCN0000014740 CCAAATCCAATGTGAGTTCAT pLKO.1 1002 CDS 100% 4.950 3.465 N NFIL3 n/a
9 TRCN0000014739 CCCATCCATTCTCCAGTTGAA pLKO.1 1430 CDS 100% 4.950 3.465 N NFIL3 n/a
10 TRCN0000234569 CCAAAGCCATGCAGATCAAAG pLKO_005 1530 CDS 100% 10.800 6.480 N NFIL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01092 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01092 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475363 GCCAGCGAGGAGGCCTTGCGTATA pLX_317 31% 100% 100% V5 n/a
Download CSV