Transcript: Human NM_001290131.2

Homo sapiens PHD finger protein 12 (PHF12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PHF12 (57649)
Length:
7893
CDS:
559..3108

Additional Resources:

NCBI RefSeq record:
NM_001290131.2
NBCI Gene record:
PHF12 (57649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230208 TGCGCTCCAGTGCAGCATATT pLKO_005 1869 CDS 100% 13.200 18.480 N PHF12 n/a
2 TRCN0000422162 TGCGCTCCAGTGCAGCATATT pLKO_005 1869 CDS 100% 13.200 18.480 N Phf12 n/a
3 TRCN0000230207 TTTCGCAGCATGTCGTCAAAG pLKO_005 1592 CDS 100% 10.800 15.120 N PHF12 n/a
4 TRCN0000084421 CCCAAGCAGTATTGTTGCCAA pLKO.1 6250 3UTR 100% 2.640 2.112 N Phf12 n/a
5 TRCN0000218527 GAAGGTTCCTGATGCTATAAA pLKO_005 1689 CDS 100% 15.000 10.500 N PHF12 n/a
6 TRCN0000416950 GAAGGTTCCTGATGCTATAAA pLKO_005 1689 CDS 100% 15.000 10.500 N Phf12 n/a
7 TRCN0000084419 CCAACTCACTTCGAGCATTTA pLKO.1 2738 CDS 100% 13.200 9.240 N Phf12 n/a
8 TRCN0000015703 GCTGATATTAAGCCTGTTATT pLKO.1 1948 CDS 100% 13.200 9.240 N PHF12 n/a
9 TRCN0000234397 TCGTTCCCTTACCCGTCAAAG pLKO_005 1355 CDS 100% 10.800 7.560 N PHF12 n/a
10 TRCN0000015704 CCTCTCATCCAGTGTGACTAT pLKO.1 1411 CDS 100% 4.950 3.465 N PHF12 n/a
11 TRCN0000084422 CCTGAACCGAATCCACAAGAA pLKO.1 1620 CDS 100% 4.950 3.465 N Phf12 n/a
12 TRCN0000015705 CGAAAGAAACGAGAGCAGAAA pLKO.1 874 CDS 100% 4.950 3.465 N PHF12 n/a
13 TRCN0000015707 CCTCTCCTGTTTCACATGGAT pLKO.1 1435 CDS 100% 3.000 2.100 N PHF12 n/a
14 TRCN0000423891 AGACAGAGAAGGCTGATATTA pLKO_005 1937 CDS 100% 15.000 9.000 N Phf12 n/a
15 TRCN0000015706 CATCGAGAACACCAGCACTTT pLKO.1 2460 CDS 100% 4.950 2.970 N PHF12 n/a
16 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3272 3UTR 100% 4.950 2.475 Y CFLAR n/a
17 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3272 3UTR 100% 4.950 2.475 Y C19orf31 n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3270 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3270 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3270 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.