Transcript: Human NM_001290207.2

Homo sapiens decapping mRNA 1A (DCP1A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
DCP1A (55802)
Length:
5684
CDS:
262..1533

Additional Resources:

NCBI RefSeq record:
NM_001290207.2
NBCI Gene record:
DCP1A (55802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235901 GGGATTCTTGAATCGAAATTA pLKO_005 3413 3UTR 100% 15.000 21.000 N DCP1A n/a
2 TRCN0000235898 TGATATAGAAGGGACCTTATT pLKO_005 170 5UTR 100% 13.200 9.240 N DCP1A n/a
3 TRCN0000235900 TTGTGCAGCCTAAGGTGTTAT pLKO_005 1199 CDS 100% 13.200 9.240 N DCP1A n/a
4 TRCN0000021012 CCATTTCCCTTTGAGCAGTTA pLKO.1 559 CDS 100% 4.950 3.465 N DCP1A n/a
5 TRCN0000021013 CGGTAGAAGAGTTATTTGGAA pLKO.1 437 CDS 100% 3.000 2.100 N DCP1A n/a
6 TRCN0000096668 GCAGGTTCTGACCAAGAACAA pLKO.1 1494 CDS 100% 0.495 0.347 N Dcp1a n/a
7 TRCN0000021011 CTGAAGTATTTGTGCAGCCTA pLKO.1 1190 CDS 100% 2.640 1.584 N DCP1A n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4364 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03658 pDONR223 100% 72.6% 72.6% None 0_1ins363;146_147ins114 n/a
2 ccsbBroad304_03658 pLX_304 0% 72.6% 72.6% V5 0_1ins363;146_147ins114 n/a
3 TRCN0000479675 ATTATTACCGATCCATTACTGACG pLX_317 18.8% 72.6% 72.6% V5 0_1ins363;146_147ins114 n/a
Download CSV