Transcript: Mouse NM_001290444.1

Mus musculus ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) (Abo), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Abo (80908)
Length:
1660
CDS:
113..976

Additional Resources:

NCBI RefSeq record:
NM_001290444.1
NBCI Gene record:
Abo (80908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110443 GCATGATGAGAGCTATTTGAA pLKO.1 814 CDS 100% 5.625 7.875 N Abo n/a
2 TRCN0000110442 GCTTTCTACGTGAGGTGGATT pLKO.1 510 CDS 100% 4.950 6.930 N Abo n/a
3 TRCN0000110440 GCCCATAACCTCTGCTCATTT pLKO.1 1375 3UTR 100% 13.200 9.240 N Abo n/a
4 TRCN0000110441 CCCTTCGCAGTGTTTGTCTTA pLKO.1 164 CDS 100% 4.950 3.465 N Abo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.