Transcript: Mouse NM_001290527.1

Mus musculus PC4 and SFRS1 interacting protein 1 (Psip1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Psip1 (101739)
Length:
1903
CDS:
315..1310

Additional Resources:

NCBI RefSeq record:
NM_001290527.1
NBCI Gene record:
Psip1 (101739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321148 CAGACGGTGACATGGTTATTG pLKO_005 928 CDS 100% 13.200 18.480 N Psip1 n/a
2 TRCN0000012117 AGATGAAAGGTTATCCTCATT pLKO.1 355 CDS 100% 4.950 3.960 N Psip1 n/a
3 TRCN0000321149 TGACTAAAGCAGTTGACATAA pLKO_005 712 CDS 100% 13.200 9.240 N Psip1 n/a
4 TRCN0000012114 GCATCAACTAAACAATCCAAT pLKO.1 603 CDS 100% 4.950 3.465 N Psip1 n/a
5 TRCN0000012115 CCCACAAACAAACTACCCATT pLKO.1 420 CDS 100% 4.050 2.835 N Psip1 n/a
6 TRCN0000321213 CCCACAAACAAACTACCCATT pLKO_005 420 CDS 100% 4.050 2.835 N Psip1 n/a
7 TRCN0000074822 ACCCACAAACAAACTACCCAT pLKO.1 419 CDS 100% 2.640 1.848 N PSIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.