Transcript: Mouse NM_001290535.1

Mus musculus O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) (Ogt), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ogt (108155)
Length:
5218
CDS:
69..3179

Additional Resources:

NCBI RefSeq record:
NM_001290535.1
NBCI Gene record:
Ogt (108155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110396 GCTCTTAATATGCCCGTTATT pLKO.1 2349 CDS 100% 13.200 18.480 N Ogt n/a
2 TRCN0000332667 GCTCTTAATATGCCCGTTATT pLKO_005 2349 CDS 100% 13.200 18.480 N Ogt n/a
3 TRCN0000110399 GCAGTGTTATACTCGTGCCAT pLKO.1 1283 CDS 100% 2.640 3.696 N Ogt n/a
4 TRCN0000035068 CCATTATTGTAACCACCCGTT pLKO.1 2515 CDS 100% 2.160 3.024 N OGT n/a
5 TRCN0000306558 ACTACGAGCAAGGCCTAATAG pLKO_005 844 CDS 100% 13.200 9.240 N Ogt n/a
6 TRCN0000110398 CCTCTGTTCAACACCAAACAA pLKO.1 3051 CDS 100% 5.625 3.938 N Ogt n/a
7 TRCN0000332591 CCTCTGTTCAACACCAAACAA pLKO_005 3051 CDS 100% 5.625 3.938 N Ogt n/a
8 TRCN0000035065 GCCAATCATTTCATTGATCTT pLKO.1 1863 CDS 100% 4.950 3.465 N OGT n/a
9 TRCN0000110397 GCAGCTTATCTTCGTGCCTTA pLKO.1 774 CDS 100% 4.050 2.835 N Ogt n/a
10 TRCN0000332590 GCAGCTTATCTTCGTGCCTTA pLKO_005 774 CDS 100% 4.050 2.835 N Ogt n/a
11 TRCN0000110395 CCCATTTCTTTCAGCAGAAAT pLKO.1 4138 3UTR 100% 1.320 0.924 N Ogt n/a
12 TRCN0000332668 CCCATTTCTTTCAGCAGAAAT pLKO_005 4138 3UTR 100% 1.320 0.924 N Ogt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467726 CGACGCTTGCAGTCTCACCATATG pLX_317 13.7% 92.2% .6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV