Transcript: Human NM_001290553.1

Homo sapiens adiponectin receptor 1 (ADIPOR1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ADIPOR1 (51094)
Length:
2048
CDS:
171..1298

Additional Resources:

NCBI RefSeq record:
NM_001290553.1
NBCI Gene record:
ADIPOR1 (51094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063045 CGTCTATTGTCATTCAGAGAA pLKO.1 746 CDS 100% 4.950 6.930 N ADIPOR1 n/a
2 TRCN0000299277 CGTCTATTGTCATTCAGAGAA pLKO_005 746 CDS 100% 4.950 6.930 N ADIPOR1 n/a
3 TRCN0000063043 GCCCACCATGCACTTTACTAT pLKO.1 1010 CDS 100% 5.625 3.938 N ADIPOR1 n/a
4 TRCN0000299276 GCCCACCATGCACTTTACTAT pLKO_005 1010 CDS 100% 5.625 3.938 N ADIPOR1 n/a
5 TRCN0000063046 CTGCTTGGTTTCGTGCTGTTT pLKO.1 594 CDS 100% 4.950 3.465 N ADIPOR1 n/a
6 TRCN0000299279 CTGCTTGGTTTCGTGCTGTTT pLKO_005 594 CDS 100% 4.950 3.465 N ADIPOR1 n/a
7 TRCN0000063047 CCACTTCTATGGAGTCTCCAA pLKO.1 1220 CDS 100% 2.640 1.848 N ADIPOR1 n/a
8 TRCN0000299278 CCACTTCTATGGAGTCTCCAA pLKO_005 1220 CDS 100% 2.640 1.848 N ADIPOR1 n/a
9 TRCN0000063044 CCCAAAGCTGAAGAAGAGCAA pLKO.1 306 CDS 100% 2.640 1.584 N ADIPOR1 n/a
10 TRCN0000299351 CCCAAAGCTGAAGAAGAGCAA pLKO_005 306 CDS 100% 2.640 1.584 N ADIPOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03202 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03202 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471475 GAGGTCGCACTGGCTGGATGGCCA pLX_317 46.9% 100% 100% V5 n/a
Download CSV