Transcript: Mouse NM_001290718.1

Mus musculus synaptotagmin-like 4 (Sytl4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sytl4 (27359)
Length:
3325
CDS:
188..1696

Additional Resources:

NCBI RefSeq record:
NM_001290718.1
NBCI Gene record:
Sytl4 (27359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380017 AGACCTTTCGGTACGAGATTT pLKO_005 1470 CDS 100% 13.200 18.480 N Sytl4 n/a
2 TRCN0000093443 GCAGCATTATGAGTATCTATA pLKO.1 1209 CDS 100% 13.200 18.480 N Sytl4 n/a
3 TRCN0000093442 CGAGATGGAAAGGGATTTGAT pLKO.1 220 CDS 100% 5.625 7.875 N Sytl4 n/a
4 TRCN0000093440 GCTCCGTTCTTCAATGGTCAA pLKO.1 1752 3UTR 100% 4.050 5.670 N Sytl4 n/a
5 TRCN0000381855 TTGTGTGGGCTGCAATCATTT pLKO_005 424 CDS 100% 13.200 10.560 N Sytl4 n/a
6 TRCN0000093439 GCAGCTAAAGTGATTAAGATT pLKO.1 3121 3UTR 100% 5.625 3.938 N Sytl4 n/a
7 TRCN0000093441 CCAGGAGAGATTCTCTGGATA pLKO.1 828 CDS 100% 4.950 3.465 N Sytl4 n/a
8 TRCN0000060310 CCTCCCTTTACATGGAAAGAT pLKO.1 1624 CDS 100% 5.625 3.938 N SYTL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09367 pDONR223 100% 64.4% 63.7% None (many diffs) n/a
2 ccsbBroad304_09367 pLX_304 0% 64.4% 63.7% V5 (many diffs) n/a
3 TRCN0000477509 TATCCGCCCATCTGACCATCCAAC pLX_317 20.3% 64.4% 63.7% V5 (many diffs) n/a
Download CSV