Transcript: Mouse NM_001290819.1

Mus musculus zinc finger SCAN domains 29 (Zscan29), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zscan29 (99334)
Length:
5941
CDS:
1002..3506

Additional Resources:

NCBI RefSeq record:
NM_001290819.1
NBCI Gene record:
Zscan29 (99334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430485 AGCTGGGAGGCTTCGTGAATA pLKO_005 1826 CDS 100% 13.200 9.240 N Zscan29 n/a
2 TRCN0000085029 AGGTCATTTCATTGCCCATTA pLKO.1 1981 CDS 100% 10.800 7.560 N Zscan29 n/a
3 TRCN0000085031 CAGGAACCAGTCTATTACCAT pLKO.1 1627 CDS 100% 3.000 2.100 N Zscan29 n/a
4 TRCN0000085032 CCAGGTCATTTCATTGCCCAT pLKO.1 1979 CDS 100% 2.160 1.512 N Zscan29 n/a
5 TRCN0000085030 CCCTTCTTTGAAGAGATGGAA pLKO.1 1944 CDS 100% 3.000 1.800 N Zscan29 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4091 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13232 pDONR223 100% 47.5% 45% None (many diffs) n/a
2 ccsbBroad304_13232 pLX_304 0% 47.5% 45% V5 (many diffs) n/a
3 TRCN0000466428 TCGGCCCCACTTCGGGATTGCTTT pLX_317 25.2% 47.5% 45% V5 (many diffs) n/a
Download CSV