Transcript: Mouse NM_001290821.1

Mus musculus glycine receptor, alpha 1 subunit (Glra1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Glra1 (14654)
Length:
2413
CDS:
466..1839

Additional Resources:

NCBI RefSeq record:
NM_001290821.1
NBCI Gene record:
Glra1 (14654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089362 GTGTCCTACGTGAAAGCTATT pLKO.1 1378 CDS 100% 10.800 8.640 N Glra1 n/a
2 TRCN0000089360 CGTGTATCATGCAACTCGAAA pLKO.1 1001 CDS 100% 4.950 3.960 N Glra1 n/a
3 TRCN0000008725 GCACTACAACACAGGTAAATT pLKO.1 1149 CDS 100% 15.000 10.500 N GLRA1 n/a
4 TRCN0000089358 CGGACAACAAACTGCTAAGAA pLKO.1 887 CDS 100% 5.625 3.938 N Glra1 n/a
5 TRCN0000089359 CCACGGACAACAAACTGCTAA pLKO.1 884 CDS 100% 4.950 3.465 N Glra1 n/a
6 TRCN0000089361 CACAGGTAAATTCACCTGCAT pLKO.1 1158 CDS 100% 0.264 0.185 N Glra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06284 pDONR223 100% 90.5% 98.6% None (many diffs) n/a
2 ccsbBroad304_06284 pLX_304 0% 90.5% 98.6% V5 (many diffs) n/a
3 TRCN0000477267 AATTTGTACTGATGTGACGGTCAG pLX_317 15.6% 90.5% 98.6% V5 (many diffs) n/a
Download CSV