Transcript: Mouse NM_001290837.1

Mus musculus small EDRK-rich factor 2 (Serf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Serf2 (378702)
Length:
3095
CDS:
238..639

Additional Resources:

NCBI RefSeq record:
NM_001290837.1
NBCI Gene record:
Serf2 (378702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248856 GAAGCAGAGCGACTCGGTTAA pLKO_005 285 CDS 100% 10.800 15.120 N Serf2 n/a
2 TRCN0000292404 AGCGACTCGGTTAAGGGAAAG pLKO_005 292 CDS 100% 6.000 8.400 N SERF2 n/a
3 TRCN0000257825 CGCCGAGATGATGGGCTTTCT pLKO_005 313 CDS 100% 1.650 1.320 N Serf2 n/a
4 TRCN0000248855 ACAGTGTGAGGGTGCTAATTT pLKO_005 2375 3UTR 100% 15.000 10.500 N Serf2 n/a
5 TRCN0000181056 CAAACGAGAAGAAGGAGGAAC pLKO.1 412 CDS 100% 4.050 2.835 N SERF2 n/a
6 TRCN0000180615 GATCATGCAGCAGAAGCAGAA pLKO.1 386 CDS 100% 4.050 2.835 N SERF2 n/a
7 TRCN0000292475 GATCATGCAGCAGAAGCAGAA pLKO_005 386 CDS 100% 4.050 2.835 N SERF2 n/a
8 TRCN0000248857 TCGGAGATCATGCAGCAGAAG pLKO_005 381 CDS 100% 4.050 2.835 N Serf2 n/a
9 TRCN0000180405 GAAGAAGGAGGAACCCAAGTA pLKO.1 419 CDS 100% 4.950 2.970 N SERF2 n/a
10 TRCN0000248854 GAAGAAGGAGGAACCCAAGTA pLKO_005 419 CDS 100% 4.950 2.970 N Serf2 n/a
11 TRCN0000292452 GAAGAAGGAGGAACCCAAGTA pLKO_005 419 CDS 100% 4.950 2.970 N SERF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11463 pDONR223 100% 71.4% 61.7% None (many diffs) n/a
2 ccsbBroad304_11463 pLX_304 0% 71.4% 61.7% V5 (many diffs) n/a
3 TRCN0000468723 CTTGAGGTAACTACCAGAGTAATG pLX_317 92.9% 71.4% 61.7% V5 (many diffs) n/a
Download CSV